You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
sftA [2018-02-16 08:59:55]
DNA translocase, translocation of non-segregated chromosomes prior to septum closure
Molecular weight
107.00 kDa
Function
resolution of chromosome dimers
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
3,049,725 → 3,052,583
The protein
Catalyzed reaction/ biological activity
aids in moving DNA away from the closing septum, binds DNA, DNA-dependent ATPase activity PubMedtranslocation of non-segregated chromosomes prior to septum closurethe two DNA translocases SftA and SpoIIIE synergistically affect chromosome dimer resolution presumably by positioning the dif sites in close proximity, before or after completion of cell division, respectively PubMed Paralogous protein(s)
Structure
2IUT (FtsK from Pseudomonas aeruginosa, partial, 48% identity, complex with SpoIIIE) PubMed Localization
30% of the molecules in the cytoplasm (Homogeneous) PubMedsmall fraction at the membrane PubMed70% of the molecules are septumbound, co-localizes with FtsZ at nascent division sites PubMed Expression and Regulation
Biological materials
Mutant
MGNA-A438 (ytpS::erm), available at the NBRP B. subtilis, Japan1A984 ( sftA::spec), PubMed, available at BGSCBKE29805 (sftA::erm, available in the BGSC, in Fabian Commichau's, and in Jörg Stülke's lab) PubMedBKE29805 (ΔsftA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATTTATCTCTAACTCC, downstream forward: _UP4_TAATATGGGTTCATTTTCACBKK29805 (ΔsftA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATTTATCTCTAACTCC, downstream forward: _UP4_TAATATGGGTTCATTTTCAC References
Reviews
Loading
Original publications
Loading